View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_92 (Length: 345)
Name: NF10261A_low_92
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_92 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 18 - 342
Target Start/End: Original strand, 9477310 - 9477650
Alignment:
| Q |
18 |
gacaactaaagtggatatatatagttgcaaaacccttgttgaacataaacccctctacctagcttt----------------gtacaaccgcaacccatt |
101 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
9477310 |
gacaaataaagtggatatgtatagttgcaaaacccttgttgaacataaacccctcttccttccttccttccttccttccttcgtacaaccgcaacccatt |
9477409 |
T |
|
| Q |
102 |
tctgctttcacaatgaaatcaattctaaacccaaagttttcatctttatcttgcaatttccccaaannnnnnnnnnnnnnnnnnntttcacatcctcgtc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
9477410 |
tctgctttcacaatgaaatcaattctaaacccaaagttttcatctttatcttgcaatttccccaaactctcttctttctctctcttttcacatcctcttc |
9477509 |
T |
|
| Q |
202 |
aattctcaatccttttccgtaacaacccatcttcattttccaaccctcttcgcctcaactcaacaaaaccctttattcccaattctcaaaatcgaacctt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9477510 |
aattctcaatccttttccgtaacaacccatcttcattttccaaccctcttcgcctcaactcaacaaaaccctttattcccaattctcaaaatcgaacctt |
9477609 |
T |
|
| Q |
302 |
tcaagcttcatcatctacttctggtgatgtccatctcattg |
342 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||| |||||| |
|
|
| T |
9477610 |
tcaagcttcatcatctacttctggtgatattcatgtcattg |
9477650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University