View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261A_low_98 (Length: 341)
Name: NF10261A_low_98
Description: NF10261A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261A_low_98 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 229 - 341
Target Start/End: Complemental strand, 34173621 - 34173510
Alignment:
| Q |
229 |
ttatccaaaagttatcacaaaatgaatttgaacctcttgtacaaaggtcaagagttcgacctatgactcttgcgtatgaaagaaaaagtcatatcgacta |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
34173621 |
ttatccaaaagttatcacaaaatgaatttgaacctcttgtacaaaggtcaagagttcgacctatgactcttgcgtatgaaagaaaaagtc-tattgacta |
34173523 |
T |
|
| Q |
329 |
ttattctgaaaaa |
341 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
34173522 |
ttattctaaaaaa |
34173510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University