View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261_high_15 (Length: 288)
Name: NF10261_high_15
Description: NF10261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 113 - 269
Target Start/End: Original strand, 15262570 - 15262726
Alignment:
| Q |
113 |
taccatggcatcctcaaattcaccatgtgcagcatgcaagtttctacgccgaaaatgtcaaccagaatgtgcatttgcaccttattttccacctgatcag |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15262570 |
taccatggcatcctcaaattcaccatgtgcagcatgcaagtttctacgccgaaaatgccaaccagaatgtgcatttgcaccttattttccacctgatcag |
15262669 |
T |
 |
| Q |
213 |
ccacaaaaatttgcaaatgttcatagaatttttggagcaagtaatgttacaaagctt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
15262670 |
ccacaaaaatttgcaaatgttcatagaatttttggagcaagcaatgttacaaagctt |
15262726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 125 - 261
Target Start/End: Original strand, 591118 - 591254
Alignment:
| Q |
125 |
ctcaaattcaccatgtgcagcatgcaagtttctacgccgaaaatgtcaaccagaatgtgca--tttgcaccttattttccacctgatcagccacaaaaat |
222 |
Q |
| |
|
||||||||| |||||||| || |||||||||||| | ||||||| |||||| || |||| |||||||||||||| ||||| || |||| || || | |
|
|
| T |
591118 |
ctcaaattctccatgtgctgcttgcaagtttctaagaagaaaatg-caaccaagat-tgcatttttgcaccttatttcccaccagaagagcctcataagt |
591215 |
T |
 |
| Q |
223 |
ttgcaaatgttcatagaatttttggagcaagtaatgtta |
261 |
Q |
| |
|
||||||||||||| | ||| ||||| ||||||||||||| |
|
|
| T |
591216 |
ttgcaaatgttcacaaaatatttggtgcaagtaatgtta |
591254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 126 - 157
Target Start/End: Original strand, 19281994 - 19282025
Alignment:
| Q |
126 |
tcaaattcaccatgtgcagcatgcaagtttct |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19281994 |
tcaaattcaccatgtgcagcatgcaagtttct |
19282025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University