View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261_low_16 (Length: 385)
Name: NF10261_low_16
Description: NF10261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 8e-40; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 259 - 346
Target Start/End: Original strand, 52093897 - 52093984
Alignment:
| Q |
259 |
aaaacaaagtttgaagcaagtttcctttatctaaatgaaacctaacatattttaacaacatgcaactaacatctaaggtagcttactt |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52093897 |
aaaacaaagtttgaagcaagtttcctttatctaaatgaaacctaacatattttaacaacatgcaactaacatcgaaggtagcttactt |
52093984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 52093642 - 52093708
Alignment:
| Q |
1 |
ttcaagaaactcacagttcttacaaatatggaagagcatcgagtatgtagtaattacctgataaatt |
67 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52093642 |
ttcaagaaactcaaagttcttacaaatatggaagagcaacgagtatgtagtaattacctgataaatt |
52093708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 137 - 191
Target Start/End: Original strand, 52093777 - 52093829
Alignment:
| Q |
137 |
aaaattgattctagctagatatgagttgaaaatatatgtttgaattcaatatgtt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52093777 |
aaaattgattctagctagatatgagttg--aatatatgtttgaattcaatatgtt |
52093829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 265 - 305
Target Start/End: Original strand, 52085052 - 52085092
Alignment:
| Q |
265 |
aagtttgaagcaagtttcctttatctaaatgaaacctaaca |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52085052 |
aagtttgaagcaagtttcctttatctaaatgaaaccaaaca |
52085092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University