View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261_low_17 (Length: 370)
Name: NF10261_low_17
Description: NF10261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 51 - 359
Target Start/End: Original strand, 2731016 - 2731324
Alignment:
| Q |
51 |
ctcccatcgaaccaaacatcccccagcctcttttcaagctcctcttcattgttcacctccttaaacatcacaaagtcatattttctccctcattgatccc |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2731016 |
ctcccatcgaaccaaacatcccccagcctcttttcaagctcctcttcattgttcacctccttaaacatcacaaaatcatattttctccctcattgatccc |
2731115 |
T |
|
| Q |
151 |
tcttttgagtaatatagactttccccacctcccatatttagcaaaaagtttccataactcttatcatttttacctcatcctagaagttactgaagaagaa |
250 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |||||||||| |
|
|
| T |
2731116 |
tcttttgaggaatatagactttccccacctcccatatttagcaaaaagtttccataactcttatcatttttacctcatcttaaaagttagtgaagaagaa |
2731215 |
T |
|
| Q |
251 |
ggggatggtaacctgatcaagattatgcacataccctttcctccttgtcgggtgtgcatttctcgccttttaaaaaacccatatggaccccttttcccct |
350 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
2731216 |
ggggatggtaacctgatcaagattattcacataacctttcctccttgtcgggtgtgcatttctcgccttttaaaaaacccatatgggccccttttctcct |
2731315 |
T |
|
| Q |
351 |
ttgcttctc |
359 |
Q |
| |
|
||| ||||| |
|
|
| T |
2731316 |
ttgtttctc |
2731324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University