View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261_low_27 (Length: 266)
Name: NF10261_low_27
Description: NF10261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 38974448 - 38974670
Alignment:
| Q |
19 |
atgggattactctcatcttgataaggtgaatccattttcctctctagtatggatgatgctaatgtaaacttatttgataatatatgaaaattacatattt |
118 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38974448 |
atgggcttactctcatcttgataaggtgaatccattttcctctctagtatggatgatgctaatgtaaacttatttgataatatatgaaaattacatattt |
38974547 |
T |
|
| Q |
119 |
cattttattctagacaagtcattggcatatgattactcaacaannnnnnnnatgactggacgggctttatacatagcctttaaagggactaatcttgaca |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38974548 |
cattttattctagacaagtcattagcatatgattactccacaaatttttttatgactggacgggctttatacatagcctttaaagggactaatcttgaca |
38974647 |
T |
|
| Q |
219 |
aggtgaaaccactttcttctctc |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38974648 |
aggtgaaaccactttcttctctc |
38974670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University