View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261_low_36 (Length: 242)
Name: NF10261_low_36
Description: NF10261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 16 - 207
Target Start/End: Original strand, 700977 - 701166
Alignment:
| Q |
16 |
cataattgacgtacaaaaccgttcaacacttgcgtgtcaatacaattcttcctaggttccaatgtagaaatacaaattgaagtgacaactttttatttta |
115 |
Q |
| |
|
||||||||||||||||| | ||||||||||||| ||| ||||| |||||||||||||||| || ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
700977 |
cataattgacgtacaaatc-gttcaacacttgcttgtaaatactattcttcctaggttcctatatagaactacaaattgaagtgacaactttttatttta |
701075 |
T |
 |
| Q |
116 |
taaagcttatattttgcagtggctctgcctaattaaatattgttcaatttttgtaaaaatgttactgatgtagcagatgttcaggatgcata |
207 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||| ||||||||||||| ||||||||||||||||||| ||| ||||||||||| ||| |||| |
|
|
| T |
701076 |
taaagcttatattttgtagtggctttgcctaatcaaatattgttcaa-ttttgtaaaaatgttactgctgtggcagatgttcaagatacata |
701166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University