View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10261_low_40 (Length: 239)
Name: NF10261_low_40
Description: NF10261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10261_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 4522101 - 4522331
Alignment:
| Q |
1 |
agatgagcggaaatatgttctgccgagacatgtacttttgtcgttgaaaggca-agataaggaaaatatcaatgggatcaccaaatatataagcaaggct |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4522101 |
agatgagcggaaatatgttctgccgagacatgtacttttgtcgttgaaaggcacagataaggaaaatatcaatgggatcaccaaatatataagcaaggct |
4522200 |
T |
|
| Q |
100 |
aaagaggtatttgtattgtctttatattcttg--atatatatgttaaagaaaatcggtctttacaa-----accatagagacaatgcatttctctggcca |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4522201 |
aaagaggtatttgtattgtctttatattcttgatatatatatgttaaagaaaatcggtctttacaaaccataccatagagacaatgcatttctctggcca |
4522300 |
T |
|
| Q |
193 |
gcaacataagctaacataacaacccactaac |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4522301 |
gcaacataagctaacataacaacccactaac |
4522331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 172 - 201
Target Start/End: Original strand, 4524612 - 4524641
Alignment:
| Q |
172 |
gacaatgcatttctctggccagcaacataa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4524612 |
gacaatgcatttctctggccagcaacataa |
4524641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University