View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10262_high_5 (Length: 260)
Name: NF10262_high_5
Description: NF10262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10262_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 59 - 242
Target Start/End: Complemental strand, 304659 - 304479
Alignment:
| Q |
59 |
tttgtattgatgttatatatgttacagggtttgatgtcgtagacaagggatgctgtggtgttggcagaaacaatggacaaatcacttgtcttccattaca |
158 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
304659 |
tttgtattgatgttat---tgatacagggtttgatgtcgtagacaagggatgctgtggtgttggaagaaacaatggacaaatcacttgtcttccattaca |
304563 |
T |
|
| Q |
159 |
acaagtatgtgaagatcgtgggaaatatttgttttgggatgctttccacccaactgagttggctaacattttactagccaaagc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
304562 |
acaagtatgtgaagatcgtgggaaatatttgttttgggatgctttccacccaactgagttggccaacattttactagccaaagc |
304479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University