View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10262_low_14 (Length: 242)
Name: NF10262_low_14
Description: NF10262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10262_low_14 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 13 - 129
Target Start/End: Complemental strand, 14223120 - 14223004
Alignment:
| Q |
13 |
agcacagacacttctgatcaaatacgttttcggcgtccgacatgacacatacacgacaaatattctcaaaatattattggtgtcgacatgtcagtgtcgt |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14223120 |
agcaccgacacttctgatcaaatacgttttcggcgtctgacatgacacatacacgacacatattctcaaaatattattggtgtcgacatatcagtgtcgt |
14223021 |
T |
|
| Q |
113 |
gtccggtgttgcatttc |
129 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
14223020 |
gtcaggtgttgcatttc |
14223004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 115
Target Start/End: Complemental strand, 11815850 - 11815810
Alignment:
| Q |
75 |
ttctcaaaatattattggtgtcgacatgtcagtgtcgtgtc |
115 |
Q |
| |
|
|||||||| ||||||||||||| || ||||||||||||||| |
|
|
| T |
11815850 |
ttctcaaattattattggtgtcaacgtgtcagtgtcgtgtc |
11815810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 16151808 - 16151890
Alignment:
| Q |
47 |
gtccgacatgacacatacacgacaaatattctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgttgcatttc |
129 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16151808 |
gtccgacatgacacatacacgacacatattctcaaaatattattggtgtcgacatatcagtgtcgtgtccggtgttgcatttc |
16151890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 86 - 129
Target Start/End: Original strand, 16152731 - 16152774
Alignment:
| Q |
86 |
ttattggtgtcgacatgtcagtgtcgtgtccggtgttgcatttc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16152731 |
ttattggtgtcgacatgtcagtgtcgtgtccgatgttgcatttc |
16152774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 80 - 116
Target Start/End: Complemental strand, 18638580 - 18638544
Alignment:
| Q |
80 |
aaaatattattggtgtcgacatgtcagtgtcgtgtcc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18638580 |
aaaatattattggtgtcgacatgtcagtgtcgtgtcc |
18638544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 121
Target Start/End: Original strand, 42205873 - 42205919
Alignment:
| Q |
75 |
ttctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgt |
121 |
Q |
| |
|
|||||||| |||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
42205873 |
ttctcaaattattattggtgttggcatgtcaatgtcgtgtccggtgt |
42205919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 9878067 - 9878116
Alignment:
| Q |
72 |
atattctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgt |
121 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||| ||| |||||| |
|
|
| T |
9878067 |
atattctcaaattattattggtgtcgacgtgtcagtgtcttgttcggtgt |
9878116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 9897917 - 9897966
Alignment:
| Q |
72 |
atattctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgt |
121 |
Q |
| |
|
||||||||||| ||||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
9897917 |
atattctcaaattattattggtgtcgatgtgtgagtgccgtgtccggtgt |
9897966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 121
Target Start/End: Original strand, 18146 - 18192
Alignment:
| Q |
75 |
ttctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgt |
121 |
Q |
| |
|
|||||||||| |||| ||||||||| ||||||||||||||| ||||| |
|
|
| T |
18146 |
ttctcaaaattttatcggtgtcgacgtgtcagtgtcgtgtctggtgt |
18192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 84 - 122
Target Start/End: Complemental strand, 10341068 - 10341030
Alignment:
| Q |
84 |
tattattggtgtcgacatgtcagtgtcgtgtccggtgtt |
122 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
10341068 |
tattactggtgtcgacatgtcagtgtcatgtccggtgtt |
10341030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University