View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10262_low_14 (Length: 242)

Name: NF10262_low_14
Description: NF10262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10262_low_14
NF10262_low_14
[»] chr8 (2 HSPs)
chr8 (13-129)||(14223004-14223120)
chr8 (75-115)||(11815810-11815850)
[»] chr3 (2 HSPs)
chr3 (47-129)||(16151808-16151890)
chr3 (86-129)||(16152731-16152774)
[»] chr2 (2 HSPs)
chr2 (80-116)||(18638544-18638580)
chr2 (75-121)||(42205873-42205919)
[»] chr5 (2 HSPs)
chr5 (72-121)||(9878067-9878116)
chr5 (72-121)||(9897917-9897966)
[»] scaffold0024 (1 HSPs)
scaffold0024 (75-121)||(18146-18192)
[»] chr6 (1 HSPs)
chr6 (84-122)||(10341030-10341068)


Alignment Details
Target: chr8 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 13 - 129
Target Start/End: Complemental strand, 14223120 - 14223004
Alignment:
13 agcacagacacttctgatcaaatacgttttcggcgtccgacatgacacatacacgacaaatattctcaaaatattattggtgtcgacatgtcagtgtcgt 112  Q
    ||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||    
14223120 agcaccgacacttctgatcaaatacgttttcggcgtctgacatgacacatacacgacacatattctcaaaatattattggtgtcgacatatcagtgtcgt 14223021  T
113 gtccggtgttgcatttc 129  Q
    ||| |||||||||||||    
14223020 gtcaggtgttgcatttc 14223004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 115
Target Start/End: Complemental strand, 11815850 - 11815810
Alignment:
75 ttctcaaaatattattggtgtcgacatgtcagtgtcgtgtc 115  Q
    |||||||| ||||||||||||| || |||||||||||||||    
11815850 ttctcaaattattattggtgtcaacgtgtcagtgtcgtgtc 11815810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 47 - 129
Target Start/End: Original strand, 16151808 - 16151890
Alignment:
47 gtccgacatgacacatacacgacaaatattctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgttgcatttc 129  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
16151808 gtccgacatgacacatacacgacacatattctcaaaatattattggtgtcgacatatcagtgtcgtgtccggtgttgcatttc 16151890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 86 - 129
Target Start/End: Original strand, 16152731 - 16152774
Alignment:
86 ttattggtgtcgacatgtcagtgtcgtgtccggtgttgcatttc 129  Q
    |||||||||||||||||||||||||||||||| |||||||||||    
16152731 ttattggtgtcgacatgtcagtgtcgtgtccgatgttgcatttc 16152774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 80 - 116
Target Start/End: Complemental strand, 18638580 - 18638544
Alignment:
80 aaaatattattggtgtcgacatgtcagtgtcgtgtcc 116  Q
    |||||||||||||||||||||||||||||||||||||    
18638580 aaaatattattggtgtcgacatgtcagtgtcgtgtcc 18638544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 121
Target Start/End: Original strand, 42205873 - 42205919
Alignment:
75 ttctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgt 121  Q
    |||||||| |||||||||||| | ||||||| |||||||||||||||    
42205873 ttctcaaattattattggtgttggcatgtcaatgtcgtgtccggtgt 42205919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 9878067 - 9878116
Alignment:
72 atattctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgt 121  Q
    ||||||||||| |||||||||||||||| |||||||||| ||| ||||||    
9878067 atattctcaaattattattggtgtcgacgtgtcagtgtcttgttcggtgt 9878116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 72 - 121
Target Start/End: Original strand, 9897917 - 9897966
Alignment:
72 atattctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgt 121  Q
    ||||||||||| |||||||||||||||  ||| |||| ||||||||||||    
9897917 atattctcaaattattattggtgtcgatgtgtgagtgccgtgtccggtgt 9897966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 121
Target Start/End: Original strand, 18146 - 18192
Alignment:
75 ttctcaaaatattattggtgtcgacatgtcagtgtcgtgtccggtgt 121  Q
    |||||||||| |||| ||||||||| ||||||||||||||| |||||    
18146 ttctcaaaattttatcggtgtcgacgtgtcagtgtcgtgtctggtgt 18192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 84 - 122
Target Start/End: Complemental strand, 10341068 - 10341030
Alignment:
84 tattattggtgtcgacatgtcagtgtcgtgtccggtgtt 122  Q
    ||||| ||||||||||||||||||||| |||||||||||    
10341068 tattactggtgtcgacatgtcagtgtcatgtccggtgtt 10341030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University