View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10262_low_16 (Length: 240)
Name: NF10262_low_16
Description: NF10262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10262_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 5 - 107
Target Start/End: Complemental strand, 33222850 - 33222748
Alignment:
| Q |
5 |
gagtattgcgtaacacttggaaatcatgcaaacatcgacatgataaaagaagatgatgagagtgaagatgatgaaggatacagccaggtatggactatga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33222850 |
gagtattgcgtaacacttggaaatcatgcaaacatcgacatgataaaagaagatgatgagagtgaagatgatgaaggatacagccaggtatggactatga |
33222751 |
T |
 |
| Q |
105 |
ttt |
107 |
Q |
| |
|
||| |
|
|
| T |
33222750 |
ttt |
33222748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 33231389 - 33231307
Alignment:
| Q |
19 |
acttggaaatcatgcaaacatcgacatgataaaagaagatgatgagagtgaagatgatgaaggatacagccaggtatggacta |
101 |
Q |
| |
|
||||| |||| |||| | |||| ||||| |||||||||||||||||||||| ||||||| |||||||| | ||| |||||||| |
|
|
| T |
33231389 |
acttgaaaataatgctaccatcaacatggtaaaagaagatgatgagagtgacgatgatggaggatacaacaagggatggacta |
33231307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University