View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10262_low_17 (Length: 240)
Name: NF10262_low_17
Description: NF10262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10262_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 1287710 - 1287917
Alignment:
| Q |
15 |
caaaggaataacatgaattctaaaacttcgacattacatagcaacatactcaaaggaagcatgaccagcgaaaatttgcatgaatcatagtgtttgtaag |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1287710 |
caaaggaataacacgaattctaaaacttcgacattacatagcaacatacttaaaggaagcatgaccagcgaaaatttgcatgaatcatagtgtttgtaag |
1287809 |
T |
|
| Q |
115 |
agtgtcctcttgcaacctcttgaaaccaaagcaaaaatacatggtacatcagtagaagagcaagcattacaggcaaaacttgtagcgtagtactcgatcg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1287810 |
agtgtcctcttgcaacctcttgaaaccaaagcaaaaatacatggtacatcagtagaagagcaagcattacaggcaaaacttgtagcgtagtactcgatcg |
1287909 |
T |
|
| Q |
215 |
tgctcagt |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
1287910 |
tgctcagt |
1287917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University