View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10262_low_18 (Length: 221)
Name: NF10262_low_18
Description: NF10262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10262_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 13 - 203
Target Start/End: Complemental strand, 18743771 - 18743581
Alignment:
| Q |
13 |
gagatgaagtgaatattgcttttgattgggtatcatcaccataaattgttgtggttcttctatcggatccttttaaaatgatgcatggcttgtcatatgg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18743771 |
gagatgaagtgaatattgcttttgattgaatatcatcatcataaattgttgtggttcttctatcggatccttttaaaatgatgcatggcttgtcatatgg |
18743672 |
T |
|
| Q |
113 |
aatagaaatctcttccctacacaatcaaaaaattaaaacatgagaacaatgtaaaataaatttgtaatatatgtttggtttttctttcaag |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18743671 |
aatagaaatctcttccctacacaatcaaaaaattaaaacatgagaacaatgtaaaataaatttgtaatatatgtttggtttttctttcaag |
18743581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 61 - 158
Target Start/End: Original strand, 38306136 - 38306233
Alignment:
| Q |
61 |
ttgtggttcttctatcggatccttttaaaatgatgcatggcttgtcatatggaatagaaatctcttccctacacaatcaaaaaattaaaacatgagaa |
158 |
Q |
| |
|
|||||||| ||||||| ||||||| ||||||||||||||| ||||| | |||||| |||| | ||||||||||||||||| |||||||||||||||| |
|
|
| T |
38306136 |
ttgtggttattctatcagatccttctaaaatgatgcatggtttgtcgttgggaatataaatattttccctacacaatcaaataattaaaacatgagaa |
38306233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 56 - 116
Target Start/End: Original strand, 38301703 - 38301763
Alignment:
| Q |
56 |
aattgttgtggttcttctatcggatccttttaaaatgatgcatggcttgtcatatggaata |
116 |
Q |
| |
|
||||||||||||| |||| || ||||||| |||||||||||| || |||||||| |||||| |
|
|
| T |
38301703 |
aattgttgtggtttttctgtcagatccttctaaaatgatgcacggtttgtcatagggaata |
38301763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 116
Target Start/End: Original strand, 38294986 - 38295046
Alignment:
| Q |
56 |
aattgttgtggttcttctatcggatccttttaaaatgatgcatggcttgtcatatggaata |
116 |
Q |
| |
|
|||| |||||||| |||| || ||||||| |||||||||||| || |||||||| |||||| |
|
|
| T |
38294986 |
aatttttgtggtttttctgtcagatccttctaaaatgatgcacggtttgtcatagggaata |
38295046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University