View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10262_low_5 (Length: 326)
Name: NF10262_low_5
Description: NF10262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10262_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 190 - 224
Target Start/End: Original strand, 31867824 - 31867858
Alignment:
| Q |
190 |
tttgtttgtttgtgaaagagctctgttaatgggca |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
31867824 |
tttgtttgtttgtgaaagagctctgttaatgggca |
31867858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University