View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10262_low_8 (Length: 284)

Name: NF10262_low_8
Description: NF10262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10262_low_8
NF10262_low_8
[»] chr7 (1 HSPs)
chr7 (19-267)||(6687977-6688218)
[»] chr6 (1 HSPs)
chr6 (201-254)||(5739882-5739935)
[»] chr3 (1 HSPs)
chr3 (198-243)||(50432543-50432588)
[»] chr4 (1 HSPs)
chr4 (199-254)||(3786187-3786242)
[»] scaffold0002 (1 HSPs)
scaffold0002 (201-254)||(490208-490261)
[»] chr2 (1 HSPs)
chr2 (201-254)||(42261373-42261426)


Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 267
Target Start/End: Complemental strand, 6688218 - 6687977
Alignment:
19 tttggtgagcttgttaaatgtagtttcttgtaactttgtaatgactatttgattctacattaacaggatgttctcttcatcggatataggtcattgttcg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||  |||||||||||||| ||||||||||||||||||||    
6688218 tttggtgagcttgttaaatgtagtttcttgtaactttgtaatgactatttgattctagattaaagggatgttctcttcaccggatataggtcattgttcg 6688119  T
119 accgaactgagaaagaaatattagtgtggtgttcctctactcttttttctttatcttgttttgnnnnnnnnnnnngttatgattgtgattttgctttcca 218  Q
    |||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||             |||||| ||||||||||||||||||    
6688118 accgaactgagaaacaaacattagtgtggtgttcctctactcttttttctttatcttgtttt-------ttttttgttatgtttgtgattttgctttcca 6688026  T
219 cttggttgttagattggatctagatatgttgttgtttgatataatttag 267  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
6688025 cttggttgttagattggatctagatatgttgttgtttgatataatttag 6687977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 201 - 254
Target Start/End: Complemental strand, 5739935 - 5739882
Alignment:
201 ttgtgattttgctttccacttggttgttagattggatctagatatgttgttgtt 254  Q
    ||||| ||||||||| |||||||||| |||||| ||| ||||||||||||||||    
5739935 ttgtggttttgctttacacttggttgctagattagatttagatatgttgttgtt 5739882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 198 - 243
Target Start/End: Complemental strand, 50432588 - 50432543
Alignment:
198 tgattgtgattttgctttccacttggttgttagattggatctagat 243  Q
    |||||||| ||||||||||||||| |||| ||||||||||||||||    
50432588 tgattgtggttttgctttccacttcgttgctagattggatctagat 50432543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 199 - 254
Target Start/End: Original strand, 3786187 - 3786242
Alignment:
199 gattgtgattttgctttccacttggttgttagattggatctagatatgttgttgtt 254  Q
    |||||| |||||| ||| |||||||||| || ||| ||||||||||||||||||||    
3786187 gattgtaattttgttttacacttggttgctatattagatctagatatgttgttgtt 3786242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 201 - 254
Target Start/End: Complemental strand, 490261 - 490208
Alignment:
201 ttgtgattttgctttccacttggttgttagattggatctagatatgttgttgtt 254  Q
    ||||| ||||||| | |||||||||| |||||| ||||||||||| ||||||||    
490261 ttgtggttttgctatacacttggttgctagattagatctagatatattgttgtt 490208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 201 - 254
Target Start/End: Complemental strand, 42261426 - 42261373
Alignment:
201 ttgtgattttgctttccacttggttgttagattggatctagatatgttgttgtt 254  Q
    ||||| ||||||| | |||||||||| |||||| ||||||||||| ||||||||    
42261426 ttgtggttttgctatacacttggttgctagattagatctagatatattgttgtt 42261373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University