View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10263_high_4 (Length: 259)

Name: NF10263_high_4
Description: NF10263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10263_high_4
NF10263_high_4
[»] chr3 (2 HSPs)
chr3 (1-143)||(9463100-9463243)
chr3 (74-132)||(5564173-5564231)
[»] chr2 (1 HSPs)
chr2 (74-132)||(26450884-26450942)
[»] chr7 (1 HSPs)
chr7 (74-132)||(7851862-7851920)
[»] chr1 (1 HSPs)
chr1 (74-132)||(40980423-40980481)
[»] chr8 (1 HSPs)
chr8 (86-132)||(22783186-22783232)


Alignment Details
Target: chr3 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 9463243 - 9463100
Alignment:
1 gctttggaagagtgataagcttcctcaataacatgataatttgaaactaaaataaattttc-ttcatcatattttttagaagtcaatcaatgtccattct 99  Q
    ||||||| ||| |||||||||| ||||| ||||| ||||||||||||||||| |||||||| |||| |||||| ||||||||||||||| ||||||||||    
9463243 gctttggtagattgataagcttactcaacaacataataatttgaaactaaaacaaattttccttcaacatattctttagaagtcaatcattgtccattct 9463144  T
100 tagagctttttacctgcaaacttttatatgaactttaaccagca 143  Q
    | ||||||||||||||||||||||||||||||||||||||||||    
9463143 ttgagctttttacctgcaaacttttatatgaactttaaccagca 9463100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 74 - 132
Target Start/End: Original strand, 5564173 - 5564231
Alignment:
74 tttagaagtcaatcaatgtccattcttagagctttttacctgcaaacttttatatgaac 132  Q
    ||||||||||| ||||||||||| | ||||||| |||| ||||||| ||||||||||||    
5564173 tttagaagtcagtcaatgtccatgcctagagctctttaactgcaaagttttatatgaac 5564231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 74 - 132
Target Start/End: Complemental strand, 26450942 - 26450884
Alignment:
74 tttagaagtcaatcaatgtccattcttagagctttttacctgcaaacttttatatgaac 132  Q
    ||||||||||| ||||||||||||| ||||||| |||| ||||||||||||||||||||    
26450942 tttagaagtcagtcaatgtccattcctagagctctttaactgcaaacttttatatgaac 26450884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 74 - 132
Target Start/End: Complemental strand, 7851920 - 7851862
Alignment:
74 tttagaagtcaatcaatgtccattcttagagctttttacctgcaaacttttatatgaac 132  Q
    ||||||||||| ||||||||||||| || |||| |||| ||||||| ||||||||||||    
7851920 tttagaagtcagtcaatgtccattcctaaagctctttaactgcaaagttttatatgaac 7851862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 74 - 132
Target Start/End: Original strand, 40980423 - 40980481
Alignment:
74 tttagaagtcaatcaatgtccattcttagagctttttacctgcaaacttttatatgaac 132  Q
    ||||||||||| ||||||||||||  ||||||| |||| ||||||| ||||||||||||    
40980423 tttagaagtcagtcaatgtccatttctagagctctttaactgcaaatttttatatgaac 40980481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 132
Target Start/End: Complemental strand, 22783232 - 22783186
Alignment:
86 tcaatgtccattcttagagctttttacctgcaaacttttatatgaac 132  Q
    ||||||||||||| || |||| ||||||||||| |||||||||||||    
22783232 tcaatgtccattcctaaagctctttacctgcaagcttttatatgaac 22783186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University