View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10263_low_10 (Length: 263)
Name: NF10263_low_10
Description: NF10263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10263_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 95 - 239
Target Start/End: Original strand, 48209620 - 48209764
Alignment:
| Q |
95 |
gttttagatactgcatttaataaaataatagcttatttgtctgtcactattatagaattcaactaccccgagtattttatttgctatataaacacataac |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48209620 |
gttttagatactgcatttaataaaataatagcttatttgtctgtcactattatagaattcaactaccccgagtattttatttgctatataaacacataac |
48209719 |
T |
 |
| Q |
195 |
tataagaactacaaaatctcatagcttctttgctctttcttctct |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
48209720 |
tataagaactacaacatctcatagcttctttgttctttcttctct |
48209764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University