View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10263_low_11 (Length: 259)
Name: NF10263_low_11
Description: NF10263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10263_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 9463243 - 9463100
Alignment:
| Q |
1 |
gctttggaagagtgataagcttcctcaataacatgataatttgaaactaaaataaattttc-ttcatcatattttttagaagtcaatcaatgtccattct |
99 |
Q |
| |
|
||||||| ||| |||||||||| ||||| ||||| ||||||||||||||||| |||||||| |||| |||||| ||||||||||||||| |||||||||| |
|
|
| T |
9463243 |
gctttggtagattgataagcttactcaacaacataataatttgaaactaaaacaaattttccttcaacatattctttagaagtcaatcattgtccattct |
9463144 |
T |
 |
| Q |
100 |
tagagctttttacctgcaaacttttatatgaactttaaccagca |
143 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9463143 |
ttgagctttttacctgcaaacttttatatgaactttaaccagca |
9463100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 74 - 132
Target Start/End: Original strand, 5564173 - 5564231
Alignment:
| Q |
74 |
tttagaagtcaatcaatgtccattcttagagctttttacctgcaaacttttatatgaac |
132 |
Q |
| |
|
||||||||||| ||||||||||| | ||||||| |||| ||||||| |||||||||||| |
|
|
| T |
5564173 |
tttagaagtcagtcaatgtccatgcctagagctctttaactgcaaagttttatatgaac |
5564231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 74 - 132
Target Start/End: Complemental strand, 26450942 - 26450884
Alignment:
| Q |
74 |
tttagaagtcaatcaatgtccattcttagagctttttacctgcaaacttttatatgaac |
132 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| |||| |||||||||||||||||||| |
|
|
| T |
26450942 |
tttagaagtcagtcaatgtccattcctagagctctttaactgcaaacttttatatgaac |
26450884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 74 - 132
Target Start/End: Complemental strand, 7851920 - 7851862
Alignment:
| Q |
74 |
tttagaagtcaatcaatgtccattcttagagctttttacctgcaaacttttatatgaac |
132 |
Q |
| |
|
||||||||||| ||||||||||||| || |||| |||| ||||||| |||||||||||| |
|
|
| T |
7851920 |
tttagaagtcagtcaatgtccattcctaaagctctttaactgcaaagttttatatgaac |
7851862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 74 - 132
Target Start/End: Original strand, 40980423 - 40980481
Alignment:
| Q |
74 |
tttagaagtcaatcaatgtccattcttagagctttttacctgcaaacttttatatgaac |
132 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| |||| ||||||| |||||||||||| |
|
|
| T |
40980423 |
tttagaagtcagtcaatgtccatttctagagctctttaactgcaaatttttatatgaac |
40980481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 132
Target Start/End: Complemental strand, 22783232 - 22783186
Alignment:
| Q |
86 |
tcaatgtccattcttagagctttttacctgcaaacttttatatgaac |
132 |
Q |
| |
|
||||||||||||| || |||| ||||||||||| ||||||||||||| |
|
|
| T |
22783232 |
tcaatgtccattcctaaagctctttacctgcaagcttttatatgaac |
22783186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University