View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10263_low_12 (Length: 251)
Name: NF10263_low_12
Description: NF10263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10263_low_12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 3 - 251
Target Start/End: Original strand, 43909829 - 43910067
Alignment:
| Q |
3 |
aggagaagcaaaggaggcatggttgatccaacactactcaagctaatgaagaaagttaatcaaaaggtatattgcaaattttgaattaacttttctgaaa |
102 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| || |
|
|
| T |
43909829 |
aggagaaacaaaagaggcatggttgatccaacactactcaagctaatgaagaaagttaatcaaaaggtatgttgcaaattttaaattaacttttctggaa |
43909928 |
T |
|
| Q |
103 |
tatgtttcacatgatttaaatttaattcattctcctaacacaaatactatgtgtgtgtgtatatatatatgcagaagagagtgaaagtgaaggatcttag |
202 |
Q |
| |
|
||| ||||| || |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
43909929 |
tatttttcagatcatttaaatttaattcattctcctaacacaaatacaatg----------tatatatatgcagaagagagtgaaggttaaggatcttag |
43910018 |
T |
|
| Q |
203 |
ccatttaggaaaaggcttgagaaagagaaagttaaaggtagaagaagag |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43910019 |
ccatttaggaaaaggcttgagaaagagaaagttaaaggtagaagaagag |
43910067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University