View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10263_low_18 (Length: 227)

Name: NF10263_low_18
Description: NF10263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10263_low_18
NF10263_low_18
[»] chr4 (1 HSPs)
chr4 (1-44)||(35770847-35770890)


Alignment Details
Target: chr4 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 35770847 - 35770890
Alignment:
1 aagcttgtttggtaaatttcgcaacttaaataataaattaaaac 44  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
35770847 aagcttgtttggtaaatttcgcaacttaaataataaattaaaac 35770890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University