View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10263_low_19 (Length: 208)
Name: NF10263_low_19
Description: NF10263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10263_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 17 - 173
Target Start/End: Original strand, 43619008 - 43619161
Alignment:
| Q |
17 |
agcacagaaaccagcaacgtaagcacaggccccc-tatgaaacagaaatggaaattctctctttctctccctccctcccaaaaaattgtaaacatacaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43619008 |
agcacagaaaccagcaacgtaagcacaggcccccctatgaaacagaaatggaaattctctctttctctcc----ctcccaaaaaattgtaaacatacaag |
43619103 |
T |
 |
| Q |
116 |
atgaaaaatttgatcataaaatttaatgtttacattaatttagtaggaaaatatatga |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43619104 |
atgaaaaatttgatcataaaatttaatgtttacattaatttagtaggaaaatatatga |
43619161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University