View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10265_high_19 (Length: 326)
Name: NF10265_high_19
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10265_high_19 |
 |  |
|
| [»] scaffold0237 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 101 - 190
Target Start/End: Complemental strand, 36729600 - 36729511
Alignment:
| Q |
101 |
cttcaaccagttggaactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacgtcacca |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| ||| |||||| |||| ||||||| |
|
|
| T |
36729600 |
cttcaaccagttggaactgccacctgtcctggggaatggcactttcccatggtgggaaaaaagtgttcatccccaggttaaatgtcacca |
36729511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 115 - 190
Target Start/End: Original strand, 31807076 - 31807151
Alignment:
| Q |
115 |
aactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacgtcacca |
190 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||| || | |||||||||| ||||||| ||||| |
|
|
| T |
31807076 |
aactgccacctgtcctgggaaatggaactttcccatggtgggaaagaactccccattcccagactaaacgccacca |
31807151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 101 - 187
Target Start/End: Complemental strand, 28111706 - 28111620
Alignment:
| Q |
101 |
cttcaaccagttggaactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacgtca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| ||| |||||| |||| |||| |
|
|
| T |
28111706 |
cttcaaccagttggaactgccacctgtcctggggaatggcactttcccatggtgggaaaaaagtgttcatccccaggttaaatgtca |
28111620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 112 - 189
Target Start/End: Complemental strand, 3138126 - 3138049
Alignment:
| Q |
112 |
tggaactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacgtcacc |
189 |
Q |
| |
|
|||||| ||||||||||||||||| ||| ||||| |||||||||||| |||| |||||||||||| ||||| ||||| |
|
|
| T |
3138126 |
tggaaccgccacctgtcctgggaattggaactttcccatggtgggaaccaagtttccattcccaggttaaacttcacc |
3138049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 115 - 189
Target Start/End: Complemental strand, 28376965 - 28376891
Alignment:
| Q |
115 |
aactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacgtcacc |
189 |
Q |
| |
|
|||||||||||||||||| || || ||||| | ||||| ||||| |||| |||||||||||||||||| ||||| |
|
|
| T |
28376965 |
aactgccacctgtcctggaaattgaaactttccaatggtaggaaacaagtttccattcccaggctaaacttcacc |
28376891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 112 - 189
Target Start/End: Original strand, 36220550 - 36220626
Alignment:
| Q |
112 |
tggaactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacgtcacc |
189 |
Q |
| |
|
||||||||| ||||||| |||||| ||| ||||||||||||||| | |||| |||||||||||| ||||| ||||| |
|
|
| T |
36220550 |
tggaactgctacctgtcttgggaattggagcttttccatggtggg-accaagtttccattcccaggttaaacttcacc |
36220626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 115 - 183
Target Start/End: Complemental strand, 26316994 - 26316926
Alignment:
| Q |
115 |
aactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaac |
183 |
Q |
| |
|
||||| || ||||||||||| | || ||||| ||||||||||||| |||| ||| |||||||| ||||| |
|
|
| T |
26316994 |
aactgacagctgtcctgggagaagggactttcccatggtgggaaagaagtttcctttcccaggttaaac |
26316926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 190 - 322
Target Start/End: Original strand, 47480171 - 47480297
Alignment:
| Q |
190 |
ataatttcatacctagtttatttccaaaacattgctcnnnnnnnnggactgcgtgcctaattgttatcaatgcctttttctttttcggacatttactatg |
289 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47480171 |
ataatttcatac-tagtttatttccaaaacattgctcttttttt-ggactgcgt----agttgttatcaatgcctttttctttttcggaca-ttactatg |
47480263 |
T |
 |
| Q |
290 |
ttgattgatt-actccatcatctctctgcttctc |
322 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||| |
|
|
| T |
47480264 |
ttgattgattaactccatcatctctcttcttctc |
47480297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 119 - 184
Target Start/End: Complemental strand, 34717668 - 34717603
Alignment:
| Q |
119 |
gccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacg |
184 |
Q |
| |
|
|||||||| ||||| ||| |||| ||| ||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
34717668 |
gccacctggcctggaaaagggcagtttcccatggtgggaaagaactgtccgatcccaggctaaacg |
34717603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 8e-21; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 119 - 182
Target Start/End: Original strand, 40375232 - 40375295
Alignment:
| Q |
119 |
gccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaa |
182 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
40375232 |
gccacctgtcctgggaaatggcactttcccatggtgggaaagaagtatccattcccaggctaaa |
40375295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 115 - 182
Target Start/End: Original strand, 22633105 - 22633172
Alignment:
| Q |
115 |
aactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaa |
182 |
Q |
| |
|
|||||||| ||||||||||| |||| |||| |||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
22633105 |
aactgccagctgtcctgggatatgggtctttcccatagtgggaaagaagtatccattcccaggctaaa |
22633172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 120 - 185
Target Start/End: Original strand, 38661053 - 38661118
Alignment:
| Q |
120 |
ccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacgt |
185 |
Q |
| |
|
|||| |||| |||||| ||| ||||| ||||||| ||||| |||| |||||||||||| ||||||| |
|
|
| T |
38661053 |
ccacatgtcttgggaattggaactttcccatggtaggaaacaagtttccattcccaggttaaacgt |
38661118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 125 - 189
Target Start/End: Original strand, 22939032 - 22939096
Alignment:
| Q |
125 |
tgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacgtcacc |
189 |
Q |
| |
|
|||||| | ||| |||||||| ||||||||||||| || | |||||||||||||||| |||||| |
|
|
| T |
22939032 |
tgtcctagaaaagggcactttcccatggtgggaaagaactacccattcccaggctaaatgtcacc |
22939096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 119 - 189
Target Start/End: Original strand, 16138554 - 16138624
Alignment:
| Q |
119 |
gccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacgtcacc |
189 |
Q |
| |
|
|||||||||||||| ||| | |||||| |||||||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
16138554 |
gccacctgtcctggaaaaggacactttcccatggtgggaaaaaactgtcccttcccaggctaaacgccacc |
16138624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 118 - 189
Target Start/End: Original strand, 5398712 - 5398783
Alignment:
| Q |
118 |
tgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacgtcacc |
189 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||||||| |||| |||||||||||| ||||| ||||| |
|
|
| T |
5398712 |
tgccacctgtcctgggaattggaactttcccatggtgggaaccaagtttccattcccaggttaaacttcacc |
5398783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 115 - 182
Target Start/End: Original strand, 36234194 - 36234261
Alignment:
| Q |
115 |
aactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaa |
182 |
Q |
| |
|
|||||||| ||||||||||| |||| |||| |||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
36234194 |
aactgccagctgtcctgggatatgggtctttcccatagtgggaaagaagtatccattcccaggctaaa |
36234261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 115 - 190
Target Start/End: Original strand, 41239199 - 41239274
Alignment:
| Q |
115 |
aactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacgtcacca |
190 |
Q |
| |
|
||||||||||||||||||||| || ||||| |||||||||||| |||| | |||||||||| ||||| |||||| |
|
|
| T |
41239199 |
aactgccacctgtcctgggaattgaaactttcccatggtgggaaccaagttttcattcccaggttaaacttcacca |
41239274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 119 - 185
Target Start/End: Complemental strand, 40800517 - 40800451
Alignment:
| Q |
119 |
gccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacgt |
185 |
Q |
| |
|
||||||||||||||||| ||| ||||| ||||||||||||| |||| |||||| |||| ||||||| |
|
|
| T |
40800517 |
gccacctgtcctgggaattggaactttcccatggtgggaaacaagtttccatttccagattaaacgt |
40800451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 115 - 183
Target Start/End: Original strand, 12923857 - 12923925
Alignment:
| Q |
115 |
aactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaac |
183 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| ||||||||||||| || |||||||||||||||||| |
|
|
| T |
12923857 |
aactgccacctgtcctgggatatggccctttcccatggtgggaaagaaaattccattcccaggctaaac |
12923925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 115 - 183
Target Start/End: Complemental strand, 12912186 - 12912118
Alignment:
| Q |
115 |
aactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaac |
183 |
Q |
| |
|
|||||||||||||||||||| |||| |||| ||||||||||||| || |||||||||||||||||| |
|
|
| T |
12912186 |
aactgccacctgtcctgggatgtggccctttcccatggtgggaaagaaaattccattcccaggctaaac |
12912118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 116 - 175
Target Start/End: Complemental strand, 20890272 - 20890213
Alignment:
| Q |
116 |
actgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattccca |
175 |
Q |
| |
|
||||||||||||||||| ||| | |||||| |||||||||||||||| ||||| |||||| |
|
|
| T |
20890272 |
actgccacctgtcctggaaaaggacactttcccatggtgggaaaaaactgtcctttccca |
20890213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 117 - 173
Target Start/End: Original strand, 32439909 - 32439965
Alignment:
| Q |
117 |
ctgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcc |
173 |
Q |
| |
|
|||||| ||||||||||| |||| ||||| ||||||||||||| |||| |||||||| |
|
|
| T |
32439909 |
ctgccagctgtcctgggatatggaactttcccatggtgggaaacaagtatccattcc |
32439965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0237 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0237
Description:
Target: scaffold0237; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 112 - 189
Target Start/End: Original strand, 4539 - 4616
Alignment:
| Q |
112 |
tggaactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacgtcacc |
189 |
Q |
| |
|
|||||| ||||||||||||||||| ||| ||||| | |||||||||| |||| |||||||||||| ||||| ||||| |
|
|
| T |
4539 |
tggaaccgccacctgtcctgggaattggaactttcctatggtgggaaccaagtttccattcccaggttaaacttcacc |
4616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 112 - 189
Target Start/End: Original strand, 29858337 - 29858414
Alignment:
| Q |
112 |
tggaactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaacgtcacc |
189 |
Q |
| |
|
|||||| ||||||||||||||||| ||| ||||| | |||||||||| |||| |||||||||||| ||||| ||||| |
|
|
| T |
29858337 |
tggaaccgccacctgtcctgggaattggaactttcctatggtgggaaccaagtttccattcccaggttaaacttcacc |
29858414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 115 - 182
Target Start/End: Original strand, 9846738 - 9846806
Alignment:
| Q |
115 |
aactgccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccatt-cccaggctaaa |
182 |
Q |
| |
|
|||||||||||||||||||| ||||| ||| ||||||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
9846738 |
aactgccacctgtcctgggatatggccatttcccatggtggaaaagaagtatccattccccaggctaaa |
9846806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 119 - 182
Target Start/End: Complemental strand, 43789500 - 43789437
Alignment:
| Q |
119 |
gccacctgtcctgggaaatggcacttttccatggtgggaaaaaagtgtccattcccaggctaaa |
182 |
Q |
| |
|
||||||||| |||||||||| |||| ||||||||||||| |||| |||||||||||| |||| |
|
|
| T |
43789500 |
gccacctgtactgggaaatgaacctttcccatggtgggaaagaagtatccattcccaggttaaa |
43789437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University