View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10265_high_42 (Length: 244)
Name: NF10265_high_42
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10265_high_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 35290382 - 35290162
Alignment:
| Q |
1 |
ctttgatataaatttggtctaggaagaacaacaagcagaattatgaagtcatcagactttgtaacattttgtattgtccattccattgcataatcactgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35290382 |
ctttgatataaatttggtctaggaagaacaacaagcagaattatgaagtcatcagactttgtcacattttgtattgtccattccattgcataatcactgc |
35290283 |
T |
 |
| Q |
101 |
tgatttcattactgacatcaacaacaactagtatcacctcctgtgccannnnnnnnaagactttctttttctccaagtttcagtgtataagaaaacagac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35290282 |
tgatttcattactgacatcaacaacaactagtatcacctcctgtgccattttttttaagactttctttttctccaagtttcagtgtataagaaaacagac |
35290183 |
T |
 |
| Q |
201 |
taatgttgagaaagtagaact |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35290182 |
taatgttgagaaagtagaact |
35290162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University