View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10265_high_44 (Length: 239)
Name: NF10265_high_44
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10265_high_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 37061134 - 37061358
Alignment:
| Q |
1 |
cacaatcataaccgtccctataaactgcacatgctccaacaacaacacctactaccaacacaacacttcctacactatacaaaacaccggtgaaacttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37061134 |
cacaatcataaccgtccctataaactgcacatgctccaacaacaacacctactaccaacacaacacttcctacactatacaaaacaccggtgaaacttac |
37061233 |
T |
 |
| Q |
101 |
ttcaccgttgctaataatacatatcaagctttatccacgtgtcaagctcttatagctcagaatccttataatgaacgaaacattgtacgtggtaacaact |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37061234 |
ttcaccgttgctaataacacatatcaagctttatccacgtgtcaagctcttatagctcagaatccttataatgaacgaaaaattgtacgtggtaacaact |
37061333 |
T |
 |
| Q |
201 |
taactgttcctcttcgttgtgcttg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37061334 |
taactgttcctcttcgttgtgcttg |
37061358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University