View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10265_high_51 (Length: 226)

Name: NF10265_high_51
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10265_high_51
NF10265_high_51
[»] chr5 (2 HSPs)
chr5 (1-94)||(9560410-9560503)
chr5 (150-226)||(9560558-9560634)


Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 9560410 - 9560503
Alignment:
1 catcattgacgaacattccaaacacgcccttaactttagcttaaaactaaaatgaatattattatatcattctaaacgcgaattcgaatttgga 94  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9560410 catcattgacgaacattccaaacacgcccttaactttagcttaaaactaaaatgaatattattatatcattctaaacgcgaattcgaatttgga 9560503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 150 - 226
Target Start/End: Original strand, 9560558 - 9560634
Alignment:
150 ctgagaaagtgtgagaaagtttctgtaactagcttcaacggttttagcgggaaattagttttctcttccttttagat 226  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9560558 ctgagaaagtgtgagaaaatttctgtaactagcttcaacggttttagcgggaaattagttttctcttccttttagat 9560634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University