View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10265_high_53 (Length: 221)

Name: NF10265_high_53
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10265_high_53
NF10265_high_53
[»] chr1 (1 HSPs)
chr1 (32-207)||(9877803-9877978)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 32 - 207
Target Start/End: Complemental strand, 9877978 - 9877803
Alignment:
32 cacagactatttaacttctaaactagatcaaccatggattctaaattgtggttgcatttgccaaactttgatatcatggaaaaatatattctcagttgta 131  Q
    ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
9877978 cacaggctatttaacttataaactagatcaaccatggattctaaattgtggttgcatatgccaaactttgatatcatggaaaaatatattctcagttgta 9877879  T
132 gttttgatgtcatcttagggatctctaaaccaaatgatttgaacaacccgaatttaatttttggattgaaccattt 207  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
9877878 gttttgatgtcatcttagggatctctaaaccaaatgattggaacaacccgaatttaatttttggattgaaccattt 9877803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University