View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10265_high_54 (Length: 216)
Name: NF10265_high_54
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10265_high_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 37463750 - 37463564
Alignment:
| Q |
1 |
aaccacgataaccctcgcctatgaatcttaatcacgaacccactacttgtcaaacttgtacaaaccaaaacccccctcatcgtacgactccnnnnnnntt |
100 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||| || |
|
|
| T |
37463750 |
aaccacgataaccctcacctatgaatcctaatcacgaacccactacttgtcaaacttgtacaaaccaaaaccccc-tcgtcttacgactccaaaaaa-tt |
37463653 |
T |
 |
| Q |
101 |
tgtcctttcatgccatcgatcatccggttcgattggttttcgatgttgcgaactcaccatggaccatctgcccctagcccccgccccct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37463652 |
tgtcctttcatgccatcgatcatccggtccgattggttttcaatgttgcgaactcaccatggaccatctgcccctagcccccgccccct |
37463564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University