View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10265_low_12 (Length: 429)
Name: NF10265_low_12
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10265_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 2e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 29 - 245
Target Start/End: Original strand, 41121420 - 41121640
Alignment:
| Q |
29 |
agagactcggtgctatggatagtgcactacctcttattaacggcaaaggttgtcggagaatcaagatcaataagctcacatccacggccatggacttggc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
41121420 |
agagactcggtgctatggatagtgcactgcctcttattaacggcaaaggttgtcggagaatcaagatcagtaagctcacatccacggccgtggacttggc |
41121519 |
T |
 |
| Q |
129 |
tgttgtgaaatatgtacgccgggtccaatttgaggtttcacttcattgaaccaacacttgactgatctacaagatggtagttccaaccaatcgtta---- |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41121520 |
tgttgtgaaatatgtacgccgggtccaatttgaggtttcacttcattgaaccaacactcaactgatctacaagatggtagttccaaccaatcgttaaacc |
41121619 |
T |
 |
| Q |
225 |
aacctttggttgccgttctaa |
245 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41121620 |
aacctttggttgccgttctaa |
41121640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 278 - 415
Target Start/End: Original strand, 41121681 - 41121819
Alignment:
| Q |
278 |
ttggtggtttgagtttgcaattcctaatgtgttggtaggagctagacccc-tccataggataagcacaactatgcttgtactggaaggtgacgtgtgggg |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
41121681 |
ttggtggtttgagtttgcaattcctaatgtgttggtaggagctagaccccctccataggataatcacaactatgcttatactagaaggtgacgtgtgggg |
41121780 |
T |
 |
| Q |
377 |
tgaacttaaaagattggatcatcatgcagttaaaaataa |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41121781 |
tgaacttaaaagattggatcatcatgcagttaaaaataa |
41121819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University