View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10265_low_26 (Length: 299)
Name: NF10265_low_26
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10265_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 281
Target Start/End: Complemental strand, 3225593 - 3225313
Alignment:
| Q |
1 |
caagaagggaaatgaggcaaaaaggtaaaaaacatgatggaccatgtgaagcaaccaacccaattgatagttgttggaggtgcaaagccgattgggctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225593 |
caagaagggaaatgaggcaaaaaggtaaaaaacatgatggaccatgtgaagcaaccaacccaattgatagttgttggaggtgcaaagccgattgggctgc |
3225494 |
T |
 |
| Q |
101 |
gaatcgatttcaattagccaagtgtagtaagggctttggaagaaaggcaactggtgggcttggaggtccaatctatgtggtcactgatgagtctgataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225493 |
gaatcgatttcaattagccaagtgtagtaagggctttggaagaaagacaactggtgggcttggaggtccaatctatgtggtcactgatgagtctgataat |
3225394 |
T |
 |
| Q |
201 |
gacatggtaaaccctaaacctggaacccttagatttggtgttgtccaaaagggaccattatggatcacttttgcacgtagc |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3225393 |
gacatggtaaaccctaaacctggaacccttagatttggtgctgtccaaaagggaccattatggatcacttttgcacgtagc |
3225313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University