View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10265_low_33 (Length: 270)
Name: NF10265_low_33
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10265_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 21 - 259
Target Start/End: Original strand, 1458490 - 1458730
Alignment:
| Q |
21 |
tttggtataatacttctcttctctccatctctctccnnnnnnngtttgttcatgtttatgcctcaaaaaatattggtcatgttatttattacgtcaatat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1458490 |
tttggtataatacttctcttctctccatctctctcctttttttgtttgttcatgtttatgcctcaaaaaatattggtcatgttatttattacgtcgatat |
1458589 |
T |
 |
| Q |
121 |
ttccatcaaatcaaatattattaatgtttaatttcttagagatctatatatatgaaaaatttacaatcatg-atga-nnnnnnnngttgataaatcatga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |||| ||| ||||||||||| |
|
|
| T |
1458590 |
ttccatcaaatcaaatattattaatgtttaatttcatagagatcagtatatatgaaaaatttacaatcatgaatgatttttttttgttaataaatcatga |
1458689 |
T |
 |
| Q |
219 |
atgatgctttaaatatgccgtcacataccgttttctttctt |
259 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1458690 |
atgatgctttaaatatgccgtcacatgccgttttctttctt |
1458730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University