View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10265_low_34 (Length: 263)
Name: NF10265_low_34
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10265_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 146 - 260
Target Start/End: Complemental strand, 16119417 - 16119303
Alignment:
| Q |
146 |
cttctgatatattgtagaaaaccatgtcagataaattgcaatgacattgtgttaacttgaaacatttcattggacaggtctagtgctgcagaagctccta |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
16119417 |
cttctgatatattgtagaaaaccatgtcagataaattgcaatgacattgtgttaacttaaaacatttcattggacaggtcttttgctgcagcagctccta |
16119318 |
T |
 |
| Q |
246 |
gaagtgtcaaaacgt |
260 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
16119317 |
gaagtgtcaaaacgt |
16119303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 146 - 260
Target Start/End: Original strand, 16339672 - 16339786
Alignment:
| Q |
146 |
cttctgatatattgtagaaaaccatgtcagataaattgcaatgacattgtgttaacttgaaacatttcattggacaggtctagtgctgcagaagctccta |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
16339672 |
cttctgatatattgtagaaaaccatgtcagataaattgcaatgacattgtgttaacttaaaacatttcattggacaggtcttttgctgcagcagctccta |
16339771 |
T |
 |
| Q |
246 |
gaagtgtcaaaacgt |
260 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
16339772 |
gaagtgtcaaaacgt |
16339786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University