View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10265_low_38 (Length: 254)
Name: NF10265_low_38
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10265_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 35290506 - 35290747
Alignment:
| Q |
1 |
tgctcattggcaacgtgataacaggctgcggtaaccatagtaaaggaacctcttttgatcaaagtaaaagggatgcccttcaacaaacaatctatgaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35290506 |
tgctcattggcaacgtgataacaggcggcggtaaccatagtaaaggaaactcttttgatcaaagtaaaagggatgcccttcaacaaacaatctatgaata |
35290605 |
T |
|
| Q |
101 |
tgtccacaagatgcagaagctttgcttagctaacaatctaatgcaggtaggtttcacacttaatattttacaaagtttgacaatgtannnnnnnnnnnnn |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35290606 |
tgtccacaagatgcagaagctatgcttagctaacaatctaatgcaggtaggtttcacacttaatattttacaaagtttgacaatgta-tttttttttttt |
35290704 |
T |
|
| Q |
201 |
nnggatctaatttataactattgtctcttcattctaggttcat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35290705 |
ttggatctaatttataactattgtctcttcattctaggttcat |
35290747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University