View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10265_low_53 (Length: 239)
Name: NF10265_low_53
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10265_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 225
Target Start/End: Complemental strand, 35742945 - 35742736
Alignment:
| Q |
16 |
caaaactcatgtccattaggtttatatttccactagttattgtttcattcaccaactaatttatacaattctgtttctgtataggtgctatcacgattcg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35742945 |
caaaactcatgtccattaggtttatatttccactagttattgtttcattcaccaactaatttatacaattctgtttctgtataggtgctatcgcgattcg |
35742846 |
T |
|
| Q |
116 |
aaggcttccctacaaagaagttggaagctattagaatggcggcatcattgtacaataagcttgattcaatcctcactgaacttcaaaattggaaggtagt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35742845 |
aaggcttccctacaaagaagttggaagctattagaatggcagcatcattgtacaataagcttgattcaatcctcactgaacttcaaaattggaaggtagt |
35742746 |
T |
|
| Q |
216 |
ggctcctatg |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
35742745 |
ggctcctatg |
35742736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University