View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10265_low_59 (Length: 226)
Name: NF10265_low_59
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10265_low_59 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 9560410 - 9560503
Alignment:
| Q |
1 |
catcattgacgaacattccaaacacgcccttaactttagcttaaaactaaaatgaatattattatatcattctaaacgcgaattcgaatttgga |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9560410 |
catcattgacgaacattccaaacacgcccttaactttagcttaaaactaaaatgaatattattatatcattctaaacgcgaattcgaatttgga |
9560503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 150 - 226
Target Start/End: Original strand, 9560558 - 9560634
Alignment:
| Q |
150 |
ctgagaaagtgtgagaaagtttctgtaactagcttcaacggttttagcgggaaattagttttctcttccttttagat |
226 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9560558 |
ctgagaaagtgtgagaaaatttctgtaactagcttcaacggttttagcgggaaattagttttctcttccttttagat |
9560634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University