View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10265_low_61 (Length: 221)
Name: NF10265_low_61
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10265_low_61 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 32 - 207
Target Start/End: Complemental strand, 9877978 - 9877803
Alignment:
| Q |
32 |
cacagactatttaacttctaaactagatcaaccatggattctaaattgtggttgcatttgccaaactttgatatcatggaaaaatatattctcagttgta |
131 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877978 |
cacaggctatttaacttataaactagatcaaccatggattctaaattgtggttgcatatgccaaactttgatatcatggaaaaatatattctcagttgta |
9877879 |
T |
|
| Q |
132 |
gttttgatgtcatcttagggatctctaaaccaaatgatttgaacaacccgaatttaatttttggattgaaccattt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9877878 |
gttttgatgtcatcttagggatctctaaaccaaatgattggaacaacccgaatttaatttttggattgaaccattt |
9877803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University