View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10265_low_62 (Length: 216)

Name: NF10265_low_62
Description: NF10265
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10265_low_62
NF10265_low_62
[»] chr4 (1 HSPs)
chr4 (1-189)||(37463564-37463750)


Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 37463750 - 37463564
Alignment:
1 aaccacgataaccctcgcctatgaatcttaatcacgaacccactacttgtcaaacttgtacaaaccaaaacccccctcatcgtacgactccnnnnnnntt 100  Q
    |||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||       ||    
37463750 aaccacgataaccctcacctatgaatcctaatcacgaacccactacttgtcaaacttgtacaaaccaaaaccccc-tcgtcttacgactccaaaaaa-tt 37463653  T
101 tgtcctttcatgccatcgatcatccggttcgattggttttcgatgttgcgaactcaccatggaccatctgcccctagcccccgccccct 189  Q
    |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
37463652 tgtcctttcatgccatcgatcatccggtccgattggttttcaatgttgcgaactcaccatggaccatctgcccctagcccccgccccct 37463564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University