View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10266_low_7 (Length: 228)
Name: NF10266_low_7
Description: NF10266
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10266_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 25 - 222
Target Start/End: Complemental strand, 6488205 - 6488008
Alignment:
| Q |
25 |
aagagcaccatgtggtaagttgttgcaacaaacaaaacaaacacagctaagaaattgaatgttcaagatagatttgagattggtacgaacgtacttaaat |
124 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6488205 |
aagagtaccatgtggtaagttgttgcaacaaacaaaacaaacacagctaagaaattgaagattcaagatagatttgagattggtacgaacgtactcaaat |
6488106 |
T |
|
| Q |
125 |
gctgacacagaatctacgcggatacactcatcatgtgttggaacttactcactatagtaacactacaactcatgttgatagattcttttcatctctct |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6488105 |
gctgacacagaatctacgcggatacactcatcatgtgttggaacttactcactatagtaacactacaactcatgttgatagattctttttatctctct |
6488008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University