View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10267_high_8 (Length: 306)
Name: NF10267_high_8
Description: NF10267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10267_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 26 - 294
Target Start/End: Complemental strand, 48416917 - 48416649
Alignment:
| Q |
26 |
atggggagtgagaaaagaggagttgatgttgtctctgcagttcaaaaggcaaccgtgatgactctagaaagcccactcatatctgcaattccacttaaat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48416917 |
atggggagtgagaaaagaggagttgatgttgtctctgcagttcaaaaggcaaccgtgatgactctagaaagcccactcatatctgcaattccacttaaat |
48416818 |
T |
 |
| Q |
126 |
ttgatgcacactcttatgaggttgggatgttagcaggagctagccggggccaagtctatgtttggacattgagctaagatttttattctataatatgcag |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48416817 |
ttgatgcacactcttatgaggttgggatgttagcaggagctagctggggccaagtctatgtttggacattgagctaagatttttattctataatatgcag |
48416718 |
T |
 |
| Q |
226 |
cacaaattttggagtccccatgttgttttggatgtggtattgcagcacacattctcgagtccctatgct |
294 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48416717 |
cacaaattttggagtccccgtgttgttttggatgtgatattgcagcacacattctcgagtccctatgct |
48416649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 78 - 294
Target Start/End: Complemental strand, 48422117 - 48421897
Alignment:
| Q |
78 |
ccgtgatgactctagaaagcccactcatatctgcaattccacttaaatttgatgcacactcttatgaggttgggatgttagcaggag---ctagccgggg |
174 |
Q |
| |
|
|||||||||||||||| || |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| | || |
|
|
| T |
48422117 |
ccgtgatgactctagagagtccacccatatctgcaaatccacttaaatttgatgcacactcttatgaggttgggatgttagcaggaggtagtagcggagg |
48422018 |
T |
 |
| Q |
175 |
ccaagtctatgtttggacattgagctaagatttttattctataatatgcagcacaaatt-ttggagtccccatgttgttttggatgtggtattgcagcac |
273 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
48422017 |
ccaggtctatgtttggacattgagctaagatttttattctataatatgcaacacaaattctctgagtccccgtactgttttggatgtggtattgcagcac |
48421918 |
T |
 |
| Q |
274 |
acattctcgagtccctatgct |
294 |
Q |
| |
|
| |||||||| |||| ||||| |
|
|
| T |
48421917 |
aaattctcgactccccatgct |
48421897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 37 - 217
Target Start/End: Complemental strand, 48410581 - 48410398
Alignment:
| Q |
37 |
gaaaagaggagttgatgttgtctctgcagttcaaaaggcaaccgtgatgactctagaaagcccactcatatctgcaattccacttaaatttgatgcacac |
136 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||| | | ||| ||| | ||||||| |||||||||||||||| | |||||||||| || |
|
|
| T |
48410581 |
gaaaagaggagttgacgttgtctccacagttcaaagggcaacaataaagacactacagagcccacacatatctgcaattccatgcagatttgatgcaaac |
48410482 |
T |
 |
| Q |
137 |
tcttatgaggttgggatgttagcaggagct---agccggggccaagtctatgtttggacattgagctaagatttttattctata |
217 |
Q |
| |
|
|||| ||||||||||||| ||||||||||| || | ||||| |||||| | ||||||| |||||||| |||||||||||| |
|
|
| T |
48410481 |
tcttgtgaggttgggatgctagcaggagctacaagtggaggccaggtctatatctggacatcaagctaagaattttattctata |
48410398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 48416970 - 48416940
Alignment:
| Q |
1 |
cttgattttatggtaacagggcaatatgggg |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48416970 |
cttgattttatggtaacagggcaatatgggg |
48416940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University