View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10267_low_10 (Length: 290)
Name: NF10267_low_10
Description: NF10267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10267_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 62 - 270
Target Start/End: Complemental strand, 20331755 - 20331546
Alignment:
| Q |
62 |
tcataacacattttgatgttcataatcatgtttcttttaaaactttggtatcgtgcatttgtaatat-atgttctaaaagaaaactaagaaagnnnnnnn |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20331755 |
tcataacacattttgatgttcataatcatgtttcttttaaaaccttggtatcgtgcatttgtaatattatgttctaaaagaaaactaagaaagttttttt |
20331656 |
T |
|
| Q |
161 |
nnnnnctctttttgaagaagccaaactagtccactgaattccacgtcgaggagaattgtactctaagactttgatagaagcatgctccaagatcccaagc |
260 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20331655 |
tttttctctttttgaagaagccaaactagcccactgaattccacgtcgaggagaattgtactcttagactttgatagaagcatgctccaagatcccaagc |
20331556 |
T |
|
| Q |
261 |
caacaccctc |
270 |
Q |
| |
|
|||||||||| |
|
|
| T |
20331555 |
caacaccctc |
20331546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University