View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10267_low_20 (Length: 219)
Name: NF10267_low_20
Description: NF10267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10267_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 87 - 154
Target Start/End: Complemental strand, 48431266 - 48431199
Alignment:
| Q |
87 |
atttcattcattgttattttagtatattaatgtcatgtagtcctacactgatttgtgctttcattccc |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48431266 |
atttcattcattgttattttagtatattaatgtcatgtcgtcctacactgatttgtgctttcattccc |
48431199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University