View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10267_low_20 (Length: 219)

Name: NF10267_low_20
Description: NF10267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10267_low_20
NF10267_low_20
[»] chr4 (1 HSPs)
chr4 (87-154)||(48431199-48431266)


Alignment Details
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 87 - 154
Target Start/End: Complemental strand, 48431266 - 48431199
Alignment:
87 atttcattcattgttattttagtatattaatgtcatgtagtcctacactgatttgtgctttcattccc 154  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
48431266 atttcattcattgttattttagtatattaatgtcatgtcgtcctacactgatttgtgctttcattccc 48431199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University