View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10268_high_3 (Length: 383)
Name: NF10268_high_3
Description: NF10268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10268_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 7e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 14 - 84
Target Start/End: Original strand, 489827 - 489897
Alignment:
| Q |
14 |
catagggcaaataggatccaatggattttatccttttgtagttaggaatcagaaagattcaacgatgagaa |
84 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
489827 |
catagagcaaataggatccaatggattttatccttttgtagttaggaatcagaaagattcaatgattagaa |
489897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 316
Target Start/End: Original strand, 11682219 - 11682256
Alignment:
| Q |
279 |
agttaaaatagtagcaataattaatgcatcaatagaaa |
316 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
11682219 |
agttaaaatagtagtaataattaatgcatcaatggaaa |
11682256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University