View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10268_high_6 (Length: 238)
Name: NF10268_high_6
Description: NF10268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10268_high_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 29304593 - 29304798
Alignment:
| Q |
18 |
gatacttcatttttcagaaaatcatttgacaataatatcaatgaaattgatgaatcgtatgccagtgccttcaattcctgatccatcgaagaaacatatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29304593 |
gatacttcatttttcagaaaatcatttgacaataatatcaatgaaattgatgaatcgtatgccagtgccttcaattcctgatccatcgaagaaacatatt |
29304692 |
T |
 |
| Q |
118 |
ccgaaatgctcaagactacgcgatacaagttcccttgattcagccagaactctctgtcttgaaaaacattcaccggaaattccattaacatcataagccc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29304693 |
tcgaaatgctcaagactacgcgatacaagttcccttgattcagccagaactctctgtcttgaaaaacattcaccggaaattccattaacatcataagccc |
29304792 |
T |
 |
| Q |
218 |
tctctg |
223 |
Q |
| |
|
| |||| |
|
|
| T |
29304793 |
tttctg |
29304798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 146 - 185
Target Start/End: Original strand, 29321907 - 29321946
Alignment:
| Q |
146 |
gttcccttgattcagccagaactctctgtcttgaaaaaca |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
29321907 |
gttcccttgattcagccagaactctctgttttgaacaaca |
29321946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 101
Target Start/End: Original strand, 29333000 - 29333056
Alignment:
| Q |
45 |
gacaataatatcaatgaaattgatgaatcgtatgccagtgccttcaattcctgatcc |
101 |
Q |
| |
|
|||||||| ||||| |||||||||| || |||||||| | |||||||||||| |||| |
|
|
| T |
29333000 |
gacaataacatcaacgaaattgatgcattgtatgccaatcccttcaattccttatcc |
29333056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University