View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10268_low_13 (Length: 253)
Name: NF10268_low_13
Description: NF10268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10268_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 88 - 243
Target Start/End: Complemental strand, 28268153 - 28267993
Alignment:
| Q |
88 |
tatttgtaataaaatgtgaaggagatagaatatgggtcggg-----tcggtccgggtcgggggaaactgtatgaggttcgattcagactaaatgataacc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28268153 |
tatttgtaataaaatgtgaaggagatagaagatgggtcgggtcgggtcggtccgggtcgggggaaactgtacgaggttcgattcagactaaatgataacc |
28268054 |
T |
|
| Q |
183 |
gacctcgtgttgtctctagtttctctgcacacgcgtgcttccacgtatcttactgcctttg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28268053 |
gacctcgtgttgtctctagtttctctgcacacgcgtgcttccacgtatcttactgtctttg |
28267993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 3 - 48
Target Start/End: Complemental strand, 28268243 - 28268198
Alignment:
| Q |
3 |
gattgtgtaatacgaaggaattatatagatcttaatgaaagacgga |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28268243 |
gattgtgtaatacgaaggaattatatagatcttaatgaaagacgga |
28268198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University