View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10268_low_17 (Length: 241)
Name: NF10268_low_17
Description: NF10268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10268_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 108 - 223
Target Start/End: Original strand, 33328598 - 33328713
Alignment:
| Q |
108 |
gatgatccttactctcttccacggagtttgttttgaatattagtgatgtgatggacaatattatcatcagttatcatgatcaagcagttaccatcacctc |
207 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33328598 |
gatgatccttactctcttccgcggaggttgttttgaatattagtgatgtgatggacaatattatcatcagttatcatgatcaagcaattaccatcacctc |
33328697 |
T |
|
| Q |
208 |
aaaggtatgcatctct |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
33328698 |
aaaggtatgcatctct |
33328713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University