View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10268_low_22 (Length: 235)
Name: NF10268_low_22
Description: NF10268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10268_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 12 - 218
Target Start/End: Original strand, 40621635 - 40621841
Alignment:
| Q |
12 |
aacctgtgaaaaaacccatcacaaaacataaagaaaaatgaagcattgctttcttccataaatgggnnnnnnnctttgacctttctactaaacccatctt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40621635 |
aacctgtgaaaaaacccatcacaaaacataaagaaaaatgaagcattgctttcttccataaatgggtttttttctttgacctttctactaaacccatctt |
40621734 |
T |
 |
| Q |
112 |
ctgaagaagaagaagnnnnnnnttgaccacaaaattcaggttgaaatggaataaaattgagtaattgttggaacagaatgaaggaaagggttttataata |
211 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40621735 |
ctgaagaagaagaagaaaaaaattgaccacaaaattcaggttgaaatggaataaaattgaataattgttggaacagaatgaagggaagggttttataata |
40621834 |
T |
 |
| Q |
212 |
ataatgt |
218 |
Q |
| |
|
||||||| |
|
|
| T |
40621835 |
ataatgt |
40621841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University