View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10268_low_26 (Length: 219)
Name: NF10268_low_26
Description: NF10268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10268_low_26 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 45731671 - 45731889
Alignment:
| Q |
1 |
caaccaaaccaacagtgccctttggtatgcgctcatgtacaacacaatcagcagcttcctttagagaaagacctttgaattccatcattgcagccacatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45731671 |
caaccaaaccaacagtgccctttggtatgcgctcatgtacaacacaatcagcagcttcctttagagaaagacctttgaattccatcattgcagccacatc |
45731770 |
T |
 |
| Q |
101 |
tcttgctactgtcccgcgtattagtgcttcgcctatccctgttgcagaaactgcacataattcattggcatatgttccagcacctatgagtggcgtgtca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45731771 |
tcttgctactgtcccgcgtattagtgcttcgcctatccctgttgcagaaactgcacataattcattggcatatgttccagcacctatgagtggcgtgtca |
45731870 |
T |
 |
| Q |
201 |
ccaattcgaccaaccattt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45731871 |
ccaattcgaccaaccattt |
45731889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 45737001 - 45737219
Alignment:
| Q |
1 |
caaccaaaccaacagtgccctttggtatgcgctcatgtacaacacaatcagcagcttcctttagagaaagacctttgaattccatcattgcagccacatc |
100 |
Q |
| |
|
||||||||||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45737001 |
caaccaaaccaactgtaccctttggtgtgcgctcatgtacaacacaatcagcagcttcctttagagaaagacctttgaattccatcatcgcagccacatc |
45737100 |
T |
 |
| Q |
101 |
tcttgctactgtcccgcgtattagtgcttcgcctatccctgttgcagaaactgcacataattcattggcatatgttccagcacctatgagtggcgtgtca |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45737101 |
tcttgctactgtcccgcgtattactgcttcgccttttcctgttgcagaaactgcacataattcattggcatatgttccagcacctatgagtggcgtgtcg |
45737200 |
T |
 |
| Q |
201 |
ccaattcgaccaaccattt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
45737201 |
ccaattcgaccaaccattt |
45737219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University