View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10268_low_27 (Length: 213)
Name: NF10268_low_27
Description: NF10268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10268_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 10689269 - 10689091
Alignment:
| Q |
18 |
attccaccatggattatctgcaatatatgtgcattgatgatgggatcccaagggagaagaaactttgaggcaagttttgtgactgaaccactctcaattg |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10689269 |
attccaccgtggattatctgcaatatatgtgcattgatgatgggatcccaagggagaagaaactttgaggcaagttttgtgactgaaccactctcaattg |
10689170 |
T |
 |
| Q |
118 |
gcctcaatgtcgctttgaaatcaatttgtgataattcctttggtattccaaaagcagcagttatgtcttctctatgttc |
196 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10689169 |
gcctcaatgttgctttgaaatcaatttgtgataattcctttggtattccaaaagcagcagttatgtcttctctatgttc |
10689091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University