View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10268_low_5 (Length: 383)

Name: NF10268_low_5
Description: NF10268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10268_low_5
NF10268_low_5
[»] chr5 (1 HSPs)
chr5 (14-84)||(489827-489897)
[»] chr1 (1 HSPs)
chr1 (279-316)||(11682219-11682256)


Alignment Details
Target: chr5 (Bit Score: 59; Significance: 7e-25; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 14 - 84
Target Start/End: Original strand, 489827 - 489897
Alignment:
14 catagggcaaataggatccaatggattttatccttttgtagttaggaatcagaaagattcaacgatgagaa 84  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||    
489827 catagagcaaataggatccaatggattttatccttttgtagttaggaatcagaaagattcaatgattagaa 489897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 316
Target Start/End: Original strand, 11682219 - 11682256
Alignment:
279 agttaaaatagtagcaataattaatgcatcaatagaaa 316  Q
    |||||||||||||| |||||||||||||||||| ||||    
11682219 agttaaaatagtagtaataattaatgcatcaatggaaa 11682256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University