View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10268_low_6 (Length: 317)
Name: NF10268_low_6
Description: NF10268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10268_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 12 - 198
Target Start/End: Original strand, 46874131 - 46874344
Alignment:
| Q |
12 |
gatgaagaagatgagaatgagagtgaggattagtgagagtgaaatggttttcaaagccatt-------------------ttgatctattattgtcccaa |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46874131 |
gatgaagaagatgagaatgagagtgaggattagtgagagtgaaatggttttcaaagccattattgcaatgataatagtgtttgatctattattgtcccaa |
46874230 |
T |
 |
| Q |
93 |
tgagttatgttgtgttgttga----------tactagctaactaactctaactacaattgcagaagaggactgtgatgtgaatatgtgccccatctcctt |
182 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46874231 |
tgagttatgttgtgttgttgaatgttgttgatactagctaactaact--aactacaattgcagaagaggactgtgatgtgaatatgtgccccatctcctt |
46874328 |
T |
 |
| Q |
183 |
tccgcgttctttccca |
198 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46874329 |
tccgcgttctttccca |
46874344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 239 - 301
Target Start/End: Original strand, 46874359 - 46874421
Alignment:
| Q |
239 |
tataaacttttgaagttatttcattttctcaatctcaaggattcttgctaattgtgtaagaaa |
301 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46874359 |
tataaacttttcaagtaatttcattttctcaatctcaaggattcttgctaattgtgtaagaaa |
46874421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University