View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10268_low_7 (Length: 317)
Name: NF10268_low_7
Description: NF10268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10268_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 13 - 301
Target Start/End: Original strand, 4883070 - 4883356
Alignment:
| Q |
13 |
acctgtgtgagatggttccccttcaattgcaaatgcattatgcgttgtcaaaaatgcatatttattgaatggtagagaattattctgtacatagaaaaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4883070 |
acctgtgtgagatggttccccttcaattgcaaatgcattatgcgttgtcaaaaatgcatatttattgaatggtagagaattattctgtacatagaaaaat |
4883169 |
T |
|
| Q |
113 |
ggaaacaattagcaagagattaagataaatagtattcaattttcttgtctttttacttcaaaagaaaaattgtagggtaaattgcatgtttggttaagta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4883170 |
ggaaacaattagcaagagattaagataaatactattcaattttcttgtctttttacttcaaaagaaaaattgtagggtaaattgcatgtttggttaagta |
4883269 |
T |
|
| Q |
213 |
ttgtggttgtgcaatttaggtctctcattttattctttttcacataagtatggattgacatgtcaccgtcatttaaaattcggcttatg |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||| |||||| ||||||||||||||| |
|
|
| T |
4883270 |
ttgtggttgtgcaatttaggtctctcattttattctttttcac--aagtattgattgacgtgtcactgtcattcaaaattcggcttatg |
4883356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University